Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1575645
End position: 1575671
Length: 27

DNA sequence
>NC_010804, from 1575645 to 1575671 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku GCCGAAGCAGCTGAAGCAGGCGAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1575049-1576098	Sequence	BMULJ_01481 scpB segregation and condensation protein B