Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1606543
End position: 1606569
Length: 27

DNA sequence
>NC_010804, from 1606543 to 1606569 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CCGGACGAACCCGACGAACCGGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1605058-1606743	Sequence	BMULJ_01503 - hypothetical protein (Protein is coded in complementary strand; from 1606743 to 1605058)