Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1718962
End position: 1718988
Length: 27

DNA sequence
>NC_010804, from 1718962 to 1718988 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGCTGATCGCGATGATCGCGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1718844-1719863	Sequence	BMULJ_01613 - simple sugar transporter permease