Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 177966
End position: 177992
Length: 27

DNA sequence
>NC_010804, from 177966 to 177992 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CGTGTCGTGCGTTTCGTGCGTGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176515-178086	Sequence	BMULJ_00168 fliI flagellum-specific ATP synthase (Protein is coded in complementary strand; from 178086 to 176515)