Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1874434
End position: 1874460
Length: 27

DNA sequence
>NC_010804, from 1874434 to 1874460 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGGACGCCGCAGACGCCTCGGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1872868-1875147	Sequence	BMULJ_01743 yhjG hypothetical protein (Protein is coded in complementary strand; from 1875147 to 1872868)