Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2178608
End position: 2178634
Length: 27

DNA sequence
>NC_010804, from 2178608 to 2178634 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCTCACGTCGCTCATGTCGCTCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2178630-2179043	Sequence	BMULJ_02023 - hypothetical protein (Protein is coded in complementary strand; from 2179043 to 2178630)