Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2434198
End position: 2434224
Length: 27

DNA sequence
>NC_010804, from 2434198 to 2434224 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CGTCGGGCGCGGCGGGCGCGTCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2434140-2436995	Sequence	BMULJ_02271 kdpD two-component system sensor histidine kinase (Protein is coded in complementary strand; from 2436995 to 2434140)