Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3013860
End position: 3013886
Length: 27

DNA sequence
>NC_010804, from 3013860 to 3013886 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCACGCGCCGGACGCGCCGCACGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3013801-3015450	Sequence	BMULJ_02787 - putative methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 3015450 to 3013801)