Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3388069
End position: 3388095
Length: 27

DNA sequence
>NC_010804, from 3388069 to 3388095 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku TGGCCGCCGTGCCCGCCGTGCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3387835-3388185	Sequence	BMULJ_03142 - hypothetical protein (Protein is coded in complementary strand; from 3388185 to 3387835)