Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 432282
End position: 432308
Length: 27

DNA sequence
>NC_010804, from 432282 to 432308 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGACGACGTCGACTACGTCGACGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 431184-432695	Sequence	BMULJ_00400 murD UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase