Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 867436
End position: 867462
Length: 27

DNA sequence
>NC_010804, from 867436 to 867462 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku TCCTCTTCGTCGTCTTCGTCCTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 867427-867945	Sequence	BMULJ_00792 ribH 6,7-dimethyl-8-ribityllumazine synthase (Protein is coded in complementary strand; from 867945 to 867427)