Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1753356
End position: 1753383
Length: 28

DNA sequence
>NC_010804, from 1753356 to 1753383 (28 bp); Burkholderia multivorans ATCC 17616 Tohoku GGCGCGCCGCGCGCGGCGCGCGGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1751297-1753387	Sequence	BMULJ_01641 - iron-hydroxamate transporter permease subunit
ORF... 1753384-1754184	Sequence	BMULJ_01642 - ferric iron reductase