Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1806962
End position: 1806991
Length: 30

DNA sequence
>NC_010804, from 1806962 to 1806991 (30 bp); Burkholderia multivorans ATCC 17616 Tohoku GCCCCGACGCGCCGCGCCGCGCACTGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1806341-1807579	Sequence	BMULJ_01677 cobL precorrin-6Y C5,15-methyltransferase