Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2056983
End position: 2057012
Length: 30

DNA sequence
>NC_010804, from 2056983 to 2057012 (30 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGACGGCGACGACGACGGCGACTGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2056718-2058229	Sequence	BMULJ_01911 - hypothetical protein (Protein is coded in complementary strand; from 2058229 to 2056718)