Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 208920
End position: 208949
Length: 30

DNA sequence
>NC_010804, from 208920 to 208949 (30 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGGCGCGCGACTGCGCGCGGCGGCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 208917-209984	Sequence	BMULJ_00199 - allophanate hydrolase (Protein is coded in complementary strand; from 209984 to 208917)