Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1408049
End position: 1408084
Length: 36

DNA sequence
>NC_010804, from 1408049 to 1408084 (36 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCCGCTCGTCGCGCTGATCGTCGTGCCGATCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1407983-1409281	Sequence	BMULJ_01311 - CitMHS family citrate-Mg2+:H+ or citrate-Ca2+:H+ symporter