Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1962027
End position: 1962062
Length: 36

DNA sequence
>NC_010804, from 1962027 to 1962062 (36 bp); Burkholderia multivorans ATCC 17616 Tohoku GCTCGATGCCGCGCTCGGTGCGGCGCGCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1961489-1962817	Sequence	BMULJ_01824 thrA homoserine dehydrogenase (Protein is coded in complementary strand; from 1962817 to 1961489)