Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2471103
End position: 2471138
Length: 36

DNA sequence
>NC_010804, from 2471103 to 2471138 (36 bp); Burkholderia multivorans ATCC 17616 Tohoku CCCGCCGCGCTCGCCGCCGCGTTCACCGCCGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2470864-2472327	Sequence	BMULJ_02303 deaD ATP-dependent RNA helicase (Protein is coded in complementary strand; from 2472327 to 2470864)