Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3075365
End position: 3075400
Length: 36

DNA sequence
>NC_010804, from 3075365 to 3075400 (36 bp); Burkholderia multivorans ATCC 17616 Tohoku CGGCGCGACGAGCGCCGCGCCGAGCAGCGCGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3074616-3075767	Sequence	BMULJ_02847 - hypothetical protein (Protein is coded in complementary strand; from 3075767 to 3074616)