Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1713624
End position: 1713668
Length: 45

DNA sequence
>NC_010804, from 1713624 to 1713668 (45 bp); Burkholderia multivorans ATCC 17616 Tohoku GCTCGCGCTGCTCGCGCTCGTGACGCTCGCGCTGAAGCTGCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1712810-1713757	Sequence	BMULJ_01608 cysW sulfate transporter permease