Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1892180
End position: 1892224
Length: 45

DNA sequence
>NC_010804, from 1892180 to 1892224 (45 bp); Burkholderia multivorans ATCC 17616 Tohoku CGAAATCGTCGTCGTCGATGCCGTCGTCGTCGAATTCCTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1892131-1893333	Sequence	BMULJ_01761 rluD ribosomal large subunit pseudouridine synthase D (Protein is coded in complementary strand; from 1893333 to 1892131)