Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2063484
End position: 2063528
Length: 45

DNA sequence
>NC_010804, from 2063484 to 2063528 (45 bp); Burkholderia multivorans ATCC 17616 Tohoku AGCGGCGCACCGCGAAGCGCAGCCCCGCGAAGCGGCGCGCATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2063003-2063713	Sequence	BMULJ_01918 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (Protein is coded in complementary strand; from 2063713 to 2063003)