Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3390407
End position: 3390478
Length: 72

DNA sequence
>NC_010804, from 3390407 to 3390478 (72 bp); Burkholderia multivorans ATCC 17616 Tohoku GTCCTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGG TC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3388200-3390788	Sequence	BMULJ_03143 zntA Cd2+-exporting ATPase (Protein is coded in complementary strand; from 3390788 to 3388200)