Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 1362820
End position: 1362879
Length: 60

DNA sequence
>NC_010939, from 1362820 to 1362879 (60 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 CTTCCGTTTTTTCTACTTCTGCTTTTTCCACTTCCGTTTTCTCCGCTTCTGTCTTTGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1362789-1364303	Sequence	APP7_1213 - zinc protease (Protein is coded in complementary strand; from 1364303 to 1362789)