Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 1663043
End position: 1663066
Length: 24

DNA sequence
>NC_010939, from 1663043 to 1663066 (24 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 TCATGATCATGGTGATGATCATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1662518-1663495	Sequence	APP7_1492 - high-affinity zinc uptake system protein ZnuA precursor (Protein is coded in complementary strand; from 1663495 to 1662518)