Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 330510
End position: 330545
Length: 36

DNA sequence
>NC_010939, from 330510 to 330545 (36 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 GAGCTGGAAGCTACGCTGGAAGCTACGCTGGAAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 329971-331137	Sequence	APP7_0295 - type I restriction enzyme EcoR124II specificity protein