Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 386533
End position: 386568
Length: 36

DNA sequence
>NC_010939, from 386533 to 386568 (36 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 AGCCGCCGCCAAAGCCGCCCCCGAATCCTCCGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 386430-387269	Sequence	APP7_0345 - hypothetical protein (Protein is coded in complementary strand; from 387269 to 386430)