Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 523296
End position: 523367
Length: 72

DNA sequence
>NC_010939, from 523296 to 523367 (72 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 GCCGTACACCCGAGCGTCGCCGTACACCCGAGCGTCGCCGTACACCCGAGCGTCGCCGTACACCCGAGCG TC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 522868-523824	Sequence	APP7_0464 - hypothetical protein (Protein is coded in complementary strand; from 523824 to 522868)