Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 87140
End position: 87175
Length: 36

DNA sequence
>NC_010939, from 87140 to 87175 (36 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 TTTGGTTTTTCCTTAGGCTTTTCCTTCGGTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 86600-87457	Sequence	APP7_0076 - protein TonB2 (Protein is coded in complementary strand; from 87457 to 86600)