Sequence retrieval

Genome: Actinobacillus pleuropneumoniae serovar 7 str. AP76
Start position: 927420
End position: 927443
Length: 24

DNA sequence
>NC_010939, from 927420 to 927443 (24 bp); Actinobacillus pleuropneumoniae serovar 7 str. AP76 GGTGCTGGTGCAGCTGCTTGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 926400-928298	Sequence	APP7_0833 - dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex (E2) (Protein is coded in complementary strand; from 928298 to 926400)