Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1105021
End position: 1105044
Length: 24

DNA sequence
>NC_011126, from 1105021 to 1105044 (24 bp); Hydrogenobaculum sp. Y04AAS1 TTTATTTTTTTATCTTTATATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1102687-1105485	Sequence	HY04AAS1_1194 uvrA excinuclease ABC subunit A (Protein is coded in complementary strand; from 1105485 to 1102687)