Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1304117
End position: 1304140
Length: 24

DNA sequence
>NC_011126, from 1304117 to 1304140 (24 bp); Hydrogenobaculum sp. Y04AAS1 GCTTTTGCTTCTTCTTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1303937-1305328	Sequence	HY04AAS1_1390 - outer membrane efflux protein (Protein is coded in complementary strand; from 1305328 to 1303937)