Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1427907
End position: 1427930
Length: 24

DNA sequence
>NC_011126, from 1427907 to 1427930 (24 bp); Hydrogenobaculum sp. Y04AAS1 GCAAATGTAAATGCTAATGTAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1427905-1428144	Sequence	HY04AAS1_1515 - bifunctional endo-1,4-beta-xylanase xylA