Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1433514
End position: 1433537
Length: 24

DNA sequence
>NC_011126, from 1433514 to 1433537 (24 bp); Hydrogenobaculum sp. Y04AAS1 TGTTTATGTTTATATTTATGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1432130-1434778	Sequence	HY04AAS1_1519 - surface antigen (D15) (Protein is coded in complementary strand; from 1434778 to 1432130)