Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 661640
End position: 661663
Length: 24

DNA sequence
>NC_011126, from 661640 to 661663 (24 bp); Hydrogenobaculum sp. Y04AAS1 ATAAAAATAAGAATAAATATAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 660924-662390	Sequence	HY04AAS1_0725 - Type II secretory pathway component PulD-like