Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 838421
End position: 838444
Length: 24

DNA sequence
>NC_011126, from 838421 to 838444 (24 bp); Hydrogenobaculum sp. Y04AAS1 TATATAAAAATATAAACATATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 838303-838479	Sequence	HY04AAS1_0890 - hypothetical protein (Protein is coded in complementary strand; from 838479 to 838303)