Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 19605
End position: 19629
Length: 25

DNA sequence
>NC_011126, from 19605 to 19629 (25 bp); Hydrogenobaculum sp. Y04AAS1 TTTTTTGTTTATTTTTTTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 18866-19663	Sequence	HY04AAS1_0019 - 3-methyl-2-oxobutanoate hydroxymethyltransferase (Protein is coded in complementary strand; from 19663 to 18866)