Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1183902
End position: 1183928
Length: 27

DNA sequence
>NC_011126, from 1183902 to 1183928 (27 bp); Hydrogenobaculum sp. Y04AAS1 ACATGTTTGACGTGTTTGATATGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1183631-1184521	Sequence	HY04AAS1_1273 - riboflavin biosynthesis protein RibF (Protein is coded in complementary strand; from 1184521 to 1183631)