Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 490488
End position: 490514
Length: 27

DNA sequence
>NC_011126, from 490488 to 490514 (27 bp); Hydrogenobaculum sp. Y04AAS1 TAGCTTTTATAGCTTTTATAGCTTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 490445-492031	Sequence	HY04AAS1_0554 - Carbamoyl-phosphate synthase L chain ATP-binding (Protein is coded in complementary strand; from 492031 to 490445)