Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 67709
End position: 67735
Length: 27

DNA sequence
>NC_011126, from 67709 to 67735 (27 bp); Hydrogenobaculum sp. Y04AAS1 TTTACATCTTTTACTTCTTTTATATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 67679-67942	Sequence	HY04AAS1_0074 - nitrogen-fixing NifU domain-containing protein (Protein is coded in complementary strand; from 67942 to 67679)