Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1049683
End position: 1049718
Length: 36

DNA sequence
>NC_011126, from 1049683 to 1049718 (36 bp); Hydrogenobaculum sp. Y04AAS1 TTTTTTGTGCCACTTCTTGTGCCATTTTTTGTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1049651-1049851	Sequence	HY04AAS1_1133 - hypothetical protein (Protein is coded in complementary strand; from 1049851 to 1049651)