Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 892562
End position: 892597
Length: 36

DNA sequence
>NC_011126, from 892562 to 892597 (36 bp); Hydrogenobaculum sp. Y04AAS1 GGTGGTGGTGGAGGTGGTGGTGGAGGTGGTGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 892112-892807	Sequence	HY04AAS1_0950 - hypothetical protein (Protein is coded in complementary strand; from 892807 to 892112)