Sequence retrieval

Genome: Hydrogenobaculum sp. Y04AAS1
Start position: 1341716
End position: 1341769
Length: 54

DNA sequence
>NC_011126, from 1341716 to 1341769 (54 bp); Hydrogenobaculum sp. Y04AAS1 CGACAAGTCTACCACGATCCACAAGTCTACCACGATCCACAAGTATGCCACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1341609-1341809	Sequence	HY04AAS1_1424 - hypothetical protein (Protein is coded in complementary strand; from 1341809 to 1341609)