Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1113283
End position: 1113306
Length: 24

DNA sequence
>NC_011138, from 1113283 to 1113306 (24 bp); Alteromonas macleodii Deep ecotype GCTAACGCTAACGCTAACGCTAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1112426-1113454	Sequence	MADE_1005180 - UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase