Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1285973
End position: 1286026
Length: 54

DNA sequence
>NC_011138, from 1285973 to 1286026 (54 bp); Alteromonas macleodii Deep ecotype AGCCTTTAGCGGAAAAACAGCCTTTAGCGGAAAAACAGCCTTCAGCGGAAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1285575-1288199	Sequence	MADE_1006040 - B12-dependent methionine synthase