Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1313044
End position: 1313070
Length: 27

DNA sequence
>NC_011138, from 1313044 to 1313070 (27 bp); Alteromonas macleodii Deep ecotype GACCCAACCTACCCAACCGACCCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1312260-1313996	Sequence	MADE_1006150 - putative ABC transporter periplasmic peptide-binding protein (Protein is coded in complementary strand; from 1313996 to 1312260)