Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1413629
End position: 1413664
Length: 36

DNA sequence
>NC_011138, from 1413629 to 1413664 (36 bp); Alteromonas macleodii Deep ecotype TGGCAACGGTAACGGCAAGGGTAACGGCAAGGGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1412943-1414103	Sequence	MADE_1006605 - putative glycerophosphoryl diester phosphodiesterase (Protein is coded in complementary strand; from 1414103 to 1412943)