Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1442797
End position: 1442826
Length: 30

DNA sequence
>NC_011138, from 1442797 to 1442826 (30 bp); Alteromonas macleodii Deep ecotype AAAAGCAGGCAAAAACAGGCTATAGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1442274-1443065	Sequence	MADE_1006730 - putative PAP (3,5 adenosine diphosphate) 3 phosphatase (Protein is coded in complementary strand; from 1443065 to 1442274)