Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1648906
End position: 1648944
Length: 39

DNA sequence
>NC_011138, from 1648906 to 1648944 (39 bp); Alteromonas macleodii Deep ecotype TAGACCAACAAATTAGACCAACAAATTAAACCAATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1648659-1649660	Sequence	MADE_1007575 - zinc-containing alcohol dehydrogenase family protein (Protein is coded in complementary strand; from 1649660 to 1648659)