Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1651303
End position: 1651338
Length: 36

DNA sequence
>NC_011138, from 1651303 to 1651338 (36 bp); Alteromonas macleodii Deep ecotype GGAAATACGGTAAAAAATACGGTAGAAAATACGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1651252-1652199	Sequence	MADE_1007590 - ribose-phosphate pyrophosphokinase (Protein is coded in complementary strand; from 1652199 to 1651252)